86
|
Intan Technologies Llc
64 channel headstage 301 64 Channel Headstage 301, supplied by Intan Technologies Llc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/301+64+channel+headstage/10__1523_slash_eneuro__0417___25__2026-137-33-36 Average 86 stars, based on 1 article reviews
64 channel headstage 301 - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
94
|
NeuroNexus Technologies
headstage Headstage, supplied by NeuroNexus Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/Headstage/custom%40headstage%4010%2E7554%2Felife%2E36781 Average 94 stars, based on 1 article reviews
headstage - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
86
|
Intan Technologies Llc
m294520 intan rhd2000 usb interface board intan technologies M294520 Intan Rhd2000 Usb Interface Board Intan Technologies, supplied by Intan Technologies Llc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/board+interface+usb/pm38636524-716-208-209 Average 86 stars, based on 1 article reviews
m294520 intan rhd2000 usb interface board intan technologies - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Intan Technologies Llc
channel recording headstage intan technologies Channel Recording Headstage Intan Technologies, supplied by Intan Technologies Llc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/32+channel+headstage+rhd/pm38636524-716-217-220 Average 86 stars, based on 1 article reviews
channel recording headstage intan technologies - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Doric Lenses Inc
cannulae doric lenses inc Cannulae Doric Lenses Inc, supplied by Doric Lenses Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/cannulae+doric+inc+lenses/pm38636524-716-230-231 Average 86 stars, based on 1 article reviews
cannulae doric lenses inc - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Intan Technologies Llc
peripheral interface cables intan technologies Peripheral Interface Cables Intan Technologies, supplied by Intan Technologies Llc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/cables+intan+interface+peripheral+technologies/pm38636524-716-223-226 Average 86 stars, based on 1 article reviews
peripheral interface cables intan technologies - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
86
|
Noldus Information Technology
ethovision xt noldus Ethovision Xt Noldus, supplied by Noldus Information Technology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/ethovision+software+xt/pm38636524-716-174-176 Average 86 stars, based on 1 article reviews
ethovision xt noldus - by Bioz Stars,
2026-10
86/100 stars
|
Buy from Supplier |
93
|
Addgene inc
article rrid addgene 209699 flip cassette atg Article Rrid Addgene 209699 Flip Cassette Atg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/pAAV-FLEX-ArchT-GFP+(Plasmid+%2328307)/pm38636524-716-113-114 Average 93 stars, based on 1 article reviews
article rrid addgene 209699 flip cassette atg - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
94
|
Addgene inc
algorithms imagej schneider Algorithms Imagej Schneider, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/pGL4+mIL-17+2kb+RORgamma-t+mut+(Plasmid+%2320127)/pm38636524-716-145-142 Average 94 stars, based on 1 article reviews
algorithms imagej schneider - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
90
|
Addgene inc
article rrid addgene 209701 software Article Rrid Addgene 209701 Software, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/H2B-Strawberry+(Plasmid+%2320970)/pm38636524-716-141-142 Average 90 stars, based on 1 article reviews
article rrid addgene 209701 software - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
92
|
Addgene inc
pam c f archt gfp gaccacctacaaggccaaga sigma aldrich n a recombinant dna pam Pam C F Archt Gfp Gaccacctacaaggccaaga Sigma Aldrich N A Recombinant Dna Pam, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rhd2000+amplifiers+with+64-channel+headstages/pCWori-A13AMO-aaCPRct+(Plasmid+%2320117)/pm38636524-716-87-110 Average 92 stars, based on 1 article reviews
pam c f archt gfp gaccacctacaaggccaaga sigma aldrich n a recombinant dna pam - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |